ID: 1084652980_1084652986

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1084652980 1084652986
Species Human (GRCh38) Human (GRCh38)
Location 11:70499892-70499914 11:70499922-70499944
Sequence CCAACTCCAAGGGATTAATTAAA AGTGCTGCTTTTAATTGTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 202} {0: 1, 1: 1, 2: 2, 3: 26, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!