ID: 1084668707_1084668718

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1084668707 1084668718
Species Human (GRCh38) Human (GRCh38)
Location 11:70592586-70592608 11:70592622-70592644
Sequence CCTCTGTCCCTCTGTCTGCACCC AATGTGTGCAGCCCTGGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 56, 4: 654} {0: 1, 1: 0, 2: 2, 3: 10, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!