ID: 1084671295_1084671299

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1084671295 1084671299
Species Human (GRCh38) Human (GRCh38)
Location 11:70608078-70608100 11:70608098-70608120
Sequence CCAGATAAAGGTAAATGTGCCAG CAGCTGCTCTTGTGGGAAATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 112} {0: 1, 1: 0, 2: 0, 3: 20, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!