ID: 1084676866_1084676872

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1084676866 1084676872
Species Human (GRCh38) Human (GRCh38)
Location 11:70640422-70640444 11:70640435-70640457
Sequence CCCTAGAGCCACCATGGGGAGCA ATGGGGAGCAGGGCCCTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 329} {0: 1, 1: 0, 2: 7, 3: 44, 4: 445}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!