ID: 1084686683_1084686690

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1084686683 1084686690
Species Human (GRCh38) Human (GRCh38)
Location 11:70700296-70700318 11:70700320-70700342
Sequence CCCGAGTATTCAATAGTTTAACT CCATGACCACCCAGGGAGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 159} {0: 1, 1: 1, 2: 2, 3: 22, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!