|
Left Crispr |
Right Crispr |
| Crispr ID |
1084693383 |
1084693388 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:70739698-70739720
|
11:70739711-70739733
|
| Sequence |
CCTAACCCCTGCTCCTCAGAATG |
CCTCAGAATGTGACTGTATTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 17, 3: 106, 4: 498} |
{0: 220, 1: 666, 2: 1431, 3: 2158, 4: 2745} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|