ID: 1084694205_1084694220

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1084694205 1084694220
Species Human (GRCh38) Human (GRCh38)
Location 11:70744204-70744226 11:70744248-70744270
Sequence CCGAGGCTTTAGCCCAAGGCACA CAGGAAGCTCCTGCCCTTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 156} {0: 1, 1: 0, 2: 1, 3: 32, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!