ID: 1084696308_1084696312

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1084696308 1084696312
Species Human (GRCh38) Human (GRCh38)
Location 11:70757626-70757648 11:70757650-70757672
Sequence CCTAGTGGGTGGGGAATGTGCTG GTCCCCTCAAGGAGAGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 183} {0: 1, 1: 0, 2: 3, 3: 13, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!