ID: 1084697735_1084697740

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1084697735 1084697740
Species Human (GRCh38) Human (GRCh38)
Location 11:70765830-70765852 11:70765869-70765891
Sequence CCAACACTTTTCTTGAATGACAT TGAACTGCTCTGAAATTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 264} {0: 1, 1: 0, 2: 0, 3: 10, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!