ID: 1084705894_1084705898

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1084705894 1084705898
Species Human (GRCh38) Human (GRCh38)
Location 11:70815788-70815810 11:70815817-70815839
Sequence CCTGAGGCTGGTTCTGACCACAC GCCCACTGCAGTCCTGGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 175} {0: 1, 1: 0, 2: 3, 3: 28, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!