ID: 1084706593_1084706607

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1084706593 1084706607
Species Human (GRCh38) Human (GRCh38)
Location 11:70819516-70819538 11:70819563-70819585
Sequence CCTGCTTGGGAGTTGGAGCTCTG GCTTGGGAGGCAGGAGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 183} {0: 1, 1: 0, 2: 10, 3: 115, 4: 1354}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!