ID: 1084708419_1084708428

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1084708419 1084708428
Species Human (GRCh38) Human (GRCh38)
Location 11:70829419-70829441 11:70829455-70829477
Sequence CCAGGGAGAAGGGAAGGAGCCTT CCCGTCACCAGGAATACGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 375} {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!