ID: 1084711136_1084711143

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1084711136 1084711143
Species Human (GRCh38) Human (GRCh38)
Location 11:70844397-70844419 11:70844425-70844447
Sequence CCAGCCTTCACAGCCAGCATTCT AGGGGATCATCTAAAACGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 355} {0: 1, 1: 0, 2: 0, 3: 4, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!