ID: 1084712347_1084712349

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1084712347 1084712349
Species Human (GRCh38) Human (GRCh38)
Location 11:70851796-70851818 11:70851809-70851831
Sequence CCAGAGCTTGGGGTCCAGTTGGA TCCAGTTGGACCATGCGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 162} {0: 1, 1: 0, 2: 0, 3: 6, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!