ID: 1084720180_1084720190

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1084720180 1084720190
Species Human (GRCh38) Human (GRCh38)
Location 11:70900557-70900579 11:70900606-70900628
Sequence CCCCTAGTGATTCCGGGATTCTC AAGCCCAGGCACCTCCCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 54} {0: 1, 1: 0, 2: 3, 3: 29, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!