ID: 1084733146_1084733154

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1084733146 1084733154
Species Human (GRCh38) Human (GRCh38)
Location 11:71087381-71087403 11:71087408-71087430
Sequence CCCCAAAGTTGAGACACAGGGGC CTGGCAAAAGGGCTGGCGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 161} {0: 1, 1: 0, 2: 1, 3: 23, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!