ID: 1084741158_1084741166

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1084741158 1084741166
Species Human (GRCh38) Human (GRCh38)
Location 11:71140422-71140444 11:71140451-71140473
Sequence CCTGCAAGGGGAAGATTACCCTG AAAGCGTCAAACAGGCAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 6, 4: 112} {0: 1, 1: 1, 2: 1, 3: 15, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!