ID: 1084741715_1084741716

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1084741715 1084741716
Species Human (GRCh38) Human (GRCh38)
Location 11:71144311-71144333 11:71144328-71144350
Sequence CCTACTCTGCAGTCAGGTGCAAC TGCAACCTCCTCATGAAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 149} {0: 1, 1: 0, 2: 0, 3: 6, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!