ID: 1084757566_1084757571

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1084757566 1084757571
Species Human (GRCh38) Human (GRCh38)
Location 11:71249420-71249442 11:71249465-71249487
Sequence CCTGAAGAGGCTGTGCGCGTCCA ACACCCTCCCTGCTGCCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 71} {0: 1, 1: 0, 2: 7, 3: 59, 4: 416}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!