ID: 1084790016_1084790019

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1084790016 1084790019
Species Human (GRCh38) Human (GRCh38)
Location 11:71469043-71469065 11:71469086-71469108
Sequence CCTAAGTTGATCTGTGGATTCAG GAACAGGAAATTCAATAAACTGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 16, 3: 118, 4: 631} {0: 1, 1: 1, 2: 1, 3: 27, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!