ID: 1084795967_1084795976

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1084795967 1084795976
Species Human (GRCh38) Human (GRCh38)
Location 11:71504294-71504316 11:71504327-71504349
Sequence CCAGTGAGAAGCTTCCAGCTCCG TCCAGGCTGCTGAGGGTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 114} {0: 1, 1: 0, 2: 3, 3: 25, 4: 331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!