|
Left Crispr |
Right Crispr |
| Crispr ID |
1084806099 |
1084806109 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:71580050-71580072
|
11:71580100-71580122
|
| Sequence |
CCTCCTGCCTTGGCCTCCCAAAT |
CATGCAGCCTCTTTTATGTCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 437, 1: 28558, 2: 79961, 3: 162520, 4: 174890} |
{0: 2, 1: 1, 2: 2, 3: 7, 4: 121} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|