ID: 1084810254_1084810267

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1084810254 1084810267
Species Human (GRCh38) Human (GRCh38)
Location 11:71607611-71607633 11:71607646-71607668
Sequence CCACGGACTCAGCCTCCCTCCTC TTACCACTTCTTAGGTCGGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 1, 3: 1, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!