ID: 1084874402_1084874411

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1084874402 1084874411
Species Human (GRCh38) Human (GRCh38)
Location 11:72120196-72120218 11:72120231-72120253
Sequence CCAATCCCCTACATCTGTTGAGG TAATGGATACAGTTTCAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 136} {0: 1, 1: 0, 2: 14, 3: 77, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!