ID: 1084876895_1084876898

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1084876895 1084876898
Species Human (GRCh38) Human (GRCh38)
Location 11:72139723-72139745 11:72139741-72139763
Sequence CCAGATGTGGTTTGACTCAGCCC AGCCCAGGGCAACCCCAATGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 11, 4: 201} {0: 2, 1: 3, 2: 2, 3: 16, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!