ID: 1084879425_1084879431

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1084879425 1084879431
Species Human (GRCh38) Human (GRCh38)
Location 11:72159586-72159608 11:72159613-72159635
Sequence CCGCTGCATCCAGATGTGGTTCG GGCCCAGGGCAACCCCAATGAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 4, 3: 12, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!