ID: 1084888453_1084888467

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1084888453 1084888467
Species Human (GRCh38) Human (GRCh38)
Location 11:72224918-72224940 11:72224959-72224981
Sequence CCCTGAGCGTCTCGGGGCGGATG GGGCGGTGCTGAGCCCTGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 29} {0: 1, 1: 0, 2: 3, 3: 32, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!