ID: 1084891367_1084891373

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1084891367 1084891373
Species Human (GRCh38) Human (GRCh38)
Location 11:72238645-72238667 11:72238662-72238684
Sequence CCCCAGGGGTGCCTGTGGGGGTC GGGGTCCATTTGGGTACGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 282} {0: 1, 1: 0, 2: 1, 3: 3, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!