ID: 1084900642_1084900655

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1084900642 1084900655
Species Human (GRCh38) Human (GRCh38)
Location 11:72307612-72307634 11:72307658-72307680
Sequence CCTGCATCCCTCTCAATACCCAC TGGAACCACATGGCAGATAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 217} {0: 1, 1: 0, 2: 0, 3: 17, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!