ID: 1084916713_1084916728

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1084916713 1084916728
Species Human (GRCh38) Human (GRCh38)
Location 11:72434209-72434231 11:72434262-72434284
Sequence CCCCAAGTGGCAGCCGCGAGGCA CCCGGTGGCTGCCCCACGTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 69} {0: 1, 1: 0, 2: 0, 3: 17, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!