ID: 1084946654_1084946656

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1084946654 1084946656
Species Human (GRCh38) Human (GRCh38)
Location 11:72642367-72642389 11:72642381-72642403
Sequence CCAGGACCATGCTCGCAGCCGCC GCAGCCGCCCGCCCGCCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 118} {0: 1, 1: 1, 2: 13, 3: 79, 4: 434}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!