ID: 1084950126_1084950132

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1084950126 1084950132
Species Human (GRCh38) Human (GRCh38)
Location 11:72660325-72660347 11:72660360-72660382
Sequence CCATGCAGAAACTAAGGAGGGGC CCACTACAGAGGCACATATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 161} {0: 1, 1: 0, 2: 0, 3: 8, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!