ID: 1084951222_1084951228

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1084951222 1084951228
Species Human (GRCh38) Human (GRCh38)
Location 11:72666652-72666674 11:72666678-72666700
Sequence CCCTCATCCCTGTGCTCACATTG CACAGGCATCTGTATACACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 337} {0: 1, 1: 0, 2: 1, 3: 13, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!