ID: 1084951222_1084951229

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1084951222 1084951229
Species Human (GRCh38) Human (GRCh38)
Location 11:72666652-72666674 11:72666691-72666713
Sequence CCCTCATCCCTGTGCTCACATTG ATACACAGGGAACACACATACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 337} {0: 1, 1: 0, 2: 1, 3: 23, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!