ID: 1084951457_1084951466

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1084951457 1084951466
Species Human (GRCh38) Human (GRCh38)
Location 11:72668492-72668514 11:72668510-72668532
Sequence CCCCAACACATAGCAAGCCAGGG CAGGGGGTCCCTGAGGGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 182} {0: 1, 1: 0, 2: 8, 3: 62, 4: 486}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!