ID: 1084955874_1084955881

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1084955874 1084955881
Species Human (GRCh38) Human (GRCh38)
Location 11:72691325-72691347 11:72691346-72691368
Sequence CCTCCTTCCTTCCATGCCCAGGG GGATCCACACGTCCCTTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 57, 4: 537} {0: 1, 1: 0, 2: 0, 3: 6, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!