ID: 1084956176_1084956187

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1084956176 1084956187
Species Human (GRCh38) Human (GRCh38)
Location 11:72692833-72692855 11:72692881-72692903
Sequence CCAGGACAGCATGTGCAGTGATG ATGTATGTGCAGAAGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 154} {0: 1, 1: 0, 2: 3, 3: 32, 4: 352}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!