ID: 1084956803_1084956810

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1084956803 1084956810
Species Human (GRCh38) Human (GRCh38)
Location 11:72695945-72695967 11:72695981-72696003
Sequence CCAAGACTGGTCTGGTCAGAGGG CAGGGTAGGAACAGTTTTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 101} {0: 1, 1: 0, 2: 0, 3: 16, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!