ID: 1084960117_1084960131

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1084960117 1084960131
Species Human (GRCh38) Human (GRCh38)
Location 11:72712195-72712217 11:72712244-72712266
Sequence CCCCTGCGGTGGGTTCTTGTCCA ACGGGGGTGGAGCCCCCAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 76} {0: 1, 1: 0, 2: 2, 3: 19, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!