ID: 1084971036_1084971042

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1084971036 1084971042
Species Human (GRCh38) Human (GRCh38)
Location 11:72772169-72772191 11:72772207-72772229
Sequence CCCGGTGCTGCCATAGGGGGCAT CAGCGCTGCCATAGCCATAGTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 6, 4: 122} {0: 1, 1: 0, 2: 2, 3: 5, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!