ID: 1084971041_1084971051

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1084971041 1084971051
Species Human (GRCh38) Human (GRCh38)
Location 11:72772199-72772221 11:72772242-72772264
Sequence CCTGTGCACAGCGCTGCCATAGC TGTGCCCGGTGCTGCCATAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 106} {0: 3, 1: 0, 2: 2, 3: 10, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!