ID: 1084971066_1084971072

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1084971066 1084971072
Species Human (GRCh38) Human (GRCh38)
Location 11:72772311-72772333 11:72772326-72772348
Sequence CCCTGTGCCCAGTGCTGCCATAG TGCCATAGCCACAGTGGGCACGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 3, 3: 22, 4: 256} {0: 1, 1: 1, 2: 0, 3: 14, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!