ID: 1084978035_1084978051

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1084978035 1084978051
Species Human (GRCh38) Human (GRCh38)
Location 11:72814099-72814121 11:72814136-72814158
Sequence CCCGGGCCTTGAGGGCCCCGCCT CCGCGTGGGGGAAGCCTCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 268} {0: 1, 1: 0, 2: 0, 3: 11, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!