ID: 1084981210_1084981217

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1084981210 1084981217
Species Human (GRCh38) Human (GRCh38)
Location 11:72829751-72829773 11:72829801-72829823
Sequence CCGAGTCTCTGCCTGCAGAGACA CAGCAGGAAGAAAGGCCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 434} {0: 1, 1: 2, 2: 22, 3: 244, 4: 1384}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!