ID: 1085026373_1085026379

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1085026373 1085026379
Species Human (GRCh38) Human (GRCh38)
Location 11:73238998-73239020 11:73239021-73239043
Sequence CCCATTTCTAAAGTGTGCTGCTA CCTTCCATGCAGGGCGTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 148} {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!