ID: 1085028427_1085028434

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1085028427 1085028434
Species Human (GRCh38) Human (GRCh38)
Location 11:73254564-73254586 11:73254612-73254634
Sequence CCACTTGGGAGGACAGAATTATT CTCTGAGAATGAAAGGAACTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 42, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!