ID: 1085031755_1085031760

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1085031755 1085031760
Species Human (GRCh38) Human (GRCh38)
Location 11:73275371-73275393 11:73275402-73275424
Sequence CCAGCCTTTCAAATCAGCCCACA GTGTCCTATCCCTTCTATTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 195} {0: 1, 1: 0, 2: 0, 3: 9, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!