ID: 1085039130_1085039138

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1085039130 1085039138
Species Human (GRCh38) Human (GRCh38)
Location 11:73316834-73316856 11:73316872-73316894
Sequence CCATGTGGATAGATTGCAAGGGG GAGGCCAGTCAGAAGGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 100} {0: 1, 1: 0, 2: 5, 3: 32, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!