ID: 1085043816_1085043823

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1085043816 1085043823
Species Human (GRCh38) Human (GRCh38)
Location 11:73342245-73342267 11:73342269-73342291
Sequence CCTCCAAGATGGTCCCAGGTATA GACACAGGACAAGCTGGATCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 97} {0: 1, 1: 0, 2: 0, 3: 13, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!