ID: 1085048288_1085048301

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1085048288 1085048301
Species Human (GRCh38) Human (GRCh38)
Location 11:73365925-73365947 11:73365963-73365985
Sequence CCCACCACCTCCCCCAGACACAG ATACCCCAAGCTAGGGATCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 91, 4: 767} {0: 1, 1: 0, 2: 1, 3: 3, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!